Highly recommend Jacob Brush 9 months ago Worked with Seth for over 10 weeks, After I had injuries to both feet
cDNA DKFZp761E0323 (from clone DKFZp761 E 161F3 1708 2371 NM_024045 Hs.7392 0 1 hypothetical protein MGC3199 (MGC3199), mRNA 195E1 1107 1362 NM_022736 Hs.7503 1.00E-129 1 hypothetical protein FLJ14153 (FLJ14153), mR 137F5 59 666 NM_018491 Hs.7535 0 2 COBW-like protein (LOC55871), mRNA /cds=(64,9 597E1 2302 2893 AF126028 Hs.7540 0 2 unknown mRNA /cds=(0, 1261 ) /gb=AF126028 /gi= 473B6 3006 3302 AK025615 Hs.7567 1.00E-158 1 cDNA: FLJ21962 fis, clone HEP05564 /cds=UNKNOW 519H1 232 720 BG112505 Hs.7589 0 602282107F1 cDNA, 5' end /clone=IMAGE:4369729 73A9 106 3912 M20681 Hs.7594 0 8 glucose transporter-like protein-Ill (GLUT3), compl 51 D3 106 3200 NM_006931 Hs.7594 0 2 solute carrier family 2 (facilitated glucose t 596E8 1512 1748 M94046 Hs.7647 1.00E-129 2 zinc finger protein (MAZ) mRNA /cds=UNKNOWN /gb=M9404 472A8 1575 1983 NM_004576 Hs.7688 0 1 protein phosphatase 2 (formerly 2A), regulator 191A10 386 889 NM_007278 Hs.77 9 0 3 GABA(A) receptor-associated protein (GABARAP 459C4 5636 5897 AB002323 Hs.7720 2.00E-87 1 mRNA for KIAA0325 gene, partial eds /cds=(0,6265) /gb 99A12 606 1253 NM J18453 Hs.7731 0 1 uncharacterized bone marrow protein BM036 (BM 72G8 5806 6409 AB007938 Hs.7764 0 5 for KIAA0469 protein, complete eds /cds=( 45G2 6168 6404 NM_014851 Hs.7764 1.00E-132 1 KIAA0469 gene product (KIAA0469), mRNA /cds=( 172A4 371 588 NM_007273 Hs.7771 1.00E-107 1 B-cell associated protein (REA), mRNA /cds=(9 177B8 2055 2431 AK023166 Hs.7797 0 1 FLJ13104 fis, clone NT2RP3002343 /cds=(28 99B6 865 1244 NM_012461 Hs.7797 0 1 TERF1 (TRFI)-interacting nuclear factor 2 (T 160G8 727 860 U94855 Hs.7811 5.00E-66 1 translation initiation factor 347 kDa subunit 54G6 1 1007 AK001319 Hs.7837 1.00E-148 3 FLJ10457 fis, clone NT2RP1001424 /cds=UN 594A7 1295 1793 NM_013446 Hs.7838 0 4 makorin, ring finger protein, 1 (MKRN1), mRNA 188A12 1 2013 NM_017761 Hs.7862 0 3 hypothetical protein FLJ20312 (FLJ20312), mR 594A2 3060 3588 A 023813 Hs.7871 0 2 cDNA FLJ13751 fis, clone PLACE3000339, weakly 124C12 472 1251 NM_001550 Hs.7879 0 1 interferon-related developmental regulator 147A8 1381 1711 Y10313 Hs.7879 1.00E-134 1 for PC4 protein (IFRD1 gene) /cds=(219,158 Table 3A, Candidate nucleotide sequences identified using differential cDNA hybridization analysis 74H3 4430 4978 AF302505 Hs.7886 0 2 pellino 1 (PELI1) mRNA, complete eds /cds=(4038 71 G3 473 1112 NM_016224 Hs.7905 0 2 SH3 and PX domain-containing protein SH3PX1 (S 52C7 1637 2231 AB029551 Hs.7910 0 1 YEAF1 mRNA for YY1 and E4TF1 associated factor 177H5 5411 6045 AB002321 Hs.7911 0 1 KIAA0323 gene, partial eds /cds=(0,2175) /gb 114C8 1678 3078 NM_017657 Hs.7942 1.00E-149 2 hypothetical protein FLJ20080 (FLJ20080), mR 169D8 1453 2158 AK001437 Hs.7943 0 1 FLJ10575 fis, clone NT2RP2003295, highly 599G8 618 1204 NM_003796 Hs.7943 0 1 RPB5-mediating protein (RMP), mRNA /cds=(465, 127E11 107 796 NM_016099 Hs.7953 0 3 HSPC041 protein (LOC51125), mRNA /cds=(141 ,45 98D6 4769 6506 NM_001111 Hs.7957 0 2( adenosine deaminase, RNA-specific (ADAR), tr 37H10 2479 6594 X79448 Hs.7957 0 8 IFI-4 mRNA for type I protein /cds=(1165,3960) /g 178G4 4209 5132 AB028981 Hs.8021 0 4 mRNA for KIAA1058 protein, partial eds /cds=(0 118E9 630 1688 NM_006083 Hs.8024 0 2 IK cytokine, down-regulator of HLA II (IK), mRN 171A8 1658 1973 AK002026 Hs.8033 1.00E-151 1 FLJ11164 fis, clone PLACE1007226, weakly 103G5 1504 1977 NM_018346 Hs.8033 0 1 hypothetical protein FLJ11164 (FLJ1116 ), mR 179G7 2860 3032 AK022497 Hs.8068 6.00E-46 1 FLJ12435 fis, clone NT2RM1000059 /cds=(88 594A11 2327 2658 NM_018210 Hs.8083 1.00E-167 1 hypothetical protein FLJ10769 (FLJ10769), mR 103B5 1968 2448 AF267856 Hs.8084 0 1 HT033 mRNA, complete eds /cds=(203,931 ) /gb=A 98E4 1367 1808 AF113008 Hs.8102 0 7 clone FLB0708 mRNA sequence /cds=UNKNOWN /gb= 191H10 4581 5819 NM_018695 Hs.811 0 3 erbb2-interacting protein ERBIN (LOC55914), 99F1 550 2672 AB014550 Hs.8118 0 4 mRNA for KIAA0650 protein, partial eds /cds=(0 165H11 488 663 NM_024408 Hs.8121 3.00E-93 1 Notch (Drosophila) homolog 2 (NOTCH2), mRNA / 515C7 2188 2514 AL050371 Hs.8128 1.00E-114 1 mRNA
Contains a 60S AGGTATCTGAGGCACTGCTCACCT Ribosomal Protein L35A LIKE pseudogene, a gene coding for a 60S Ribosomal Protein L12 LIKE protein in an intron of the HSET gene coding for a Kinesin related protein, the PHF1 (PHF2) gene coding for alternative splice products PHD finger proteins 1 and 2, the gene coding for five different alternatively spliced mRNAs coding for a protein similar to CYTA (CYCY) and identical to a polypeptide coded for by a known patented cDNA, and the first two exons of the gene coding for the homolog of the rat synaptic ras GTPase- activating protein p135 SynGAP
From: Trey: Texas 7/28/17 Comments: I have been using this braid for quite some time now
All the links go directly to Tackle Warehouse where you can see detailed photos and descriptions of the items
